AAAAAAAAAAAAAArrrrrrgghhhhh!!!!!!!!!!!

This forum made possible through the generous support of SDN members, donors, and sponsors. Thank you.
EvoDevo

EvoDevo

Forging a Different Path
Moderator Emeritus
Verified Member
20+ Year Member
Joined
Jun 5, 2003
Messages
20,374
Reaction score
30
Members do not see this ad.
Aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa!!!!!!!!!

**This has been a regularly scheduled stress relieving scream**

I needed that. Being calm, cool, and collected all the time wears on ya.

Now, who's next???
 
Sort by date Sort by votes
Can't .......scr....scream........too.....bbbb....bb...busy.....hyp......h...hhhhh...hyperven
...........breathing too fast.
 
Upvote 0 Downvote
I just worry that AMCAS is somehow monitoring my score-checking...

"Oooo.... that Akimbo is not too bright... does she really think we've posted in the past 15 minutes?"
 
Upvote 0 Downvote
akimbo said:
I just worry that AMCAS is somehow monitoring my score-checking...

"Oooo.... that Akimbo is not too bright... does she really think we've posted in the past 15 minutes?"
Click to expand...
Now akimbo, hon....this is the "stress relief" thread.....not the obssession thread. 😉

C'mon, give it to me! Show me your War Face!!!!! :meanie:
 
Upvote 0 Downvote
EvoDevo said:
Now akimbo, hon....this is the "stress relief" thread.....not the obssession thread. 😉

C'mon, give it to me! Show me your War Face!!!!! :meanie:
Click to expand...

Dag Nabbit! I can't even get my threads right!!

BOO-HOO-HOO-HOO!! WAH-HA-HA-HA!!

*sob*

*gasp*

Ohh! I DO feel better...
 
Upvote 0 Downvote
AAAAAAAAAARRRRRRRRRRRRRRRRGGGGGGGGHHHHHHHHHHHH!!!!!!!!!!!!!!!!

*sigh* 😍 😍 😍 😍 😍

Not exactly the "stress relief" I was looking for, but it helps.
 
Upvote 0 Downvote
UNTlabrat said:
AAAAAAAAAARRRRRRRRRRRRRRRRGGGGGGGGHHHHHHHHHHHH!!!!!!!!!!!!!!!!

*sigh* 😍 😍 😍 😍 😍

Not exactly the "stress relief" I was looking for, but it helps.
Click to expand...

I really can't believe no one will help you out with that 😀

You need better friends. Maybe they're all masochists so they're enjoying your frustration.
 
Upvote 0 Downvote
MoosePilot said:
I really can't believe no one will help you out with that 😀

You need better friends. Maybe they're all masochists so they're enjoying your frustration.
Click to expand...

:laugh: :laugh: :laugh:
 
Upvote 0 Downvote
man, I can't believed we lived through waiting for MCAT scores last year.........(some of us, TWICE) 😎


yes, digging up old threads is better than studying molecular.........:laugh:
 
Upvote 0 Downvote
i'm not sure whether to cry, scream or just kill myself...ugh, i can't take this any more
 
Upvote 0 Downvote
:meanie: heeeeheeeeeeheeeeeeeeeheeeehehehehehehehehehehheeeeeeeeeeheeeeeeeeheheheheeeeeeeeeeeeeeeeeeeeeeeeeee
thats how I do it! it sucks to wait I want it now! I am holding my breath till they give me my score, it use to work when i was a kid.
 
Upvote 0 Downvote
this thread rocks, i really need a good scream, so here goes:

aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaahhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh


thanks for listening
 
Upvote 0 Downvote
*mmmeeeeoowwwww!!!!***

ahem! I mean, uhhh,

WAAAAAHHHHHAAAUURRRROOWOWWWWWRRRRRHHHGGG!!!!

(this thread is great. keep it around so next year's MCATer's can use it 😀 ...)
 
Upvote 0 Downvote
LOL excellent....I've got my own scream that brings me much joy as well

(make sure to do it with a really high pitched shreiky voice):

EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEeeeeeeeeeeeeeeeeeeeeeeeeeee
 
Upvote 0 Downvote
I don't have a scream in me right now, but it's good to know this is here when the time comes.... and it's not too far off. :scared:
 
Upvote 0 Downvote
Phil Anthropist said:
They're screaming with DNA nucleotide bases 😉
Click to expand...

I don't know whether to laugh or cry at that. Laugh because I get it and appreciate the humour, or cry because I'm that much of a geek that I get it and appreciate the humour. 😳
 
Upvote 0 Downvote
jaylily said:
I don't know whether to laugh or cry at that. Laugh because I get it and appreciate the humour, or cry because I'm that much of a geek that I get it and appreciate the humour. 😳
Click to expand...
ive already done both, it was just my first instinct after seeing a string of capital As...too much mRNA and cDNA work
 
Upvote 0 Downvote
well then...
acgtacgatcgatcgatgcatcgatcagctagc

hey its kinda fun typing that...just position your fingers on the four keys and type away...don't mind if I do some more...

acgagtacgatgatcgatcgatcgatgctagcatcgatcgatgcgatcgatcgattaatgcatgcatgc ;0
 
Upvote 0 Downvote
crazy_cavalier said:
*mmmeeeeoowwwww!!!!***

ahem! I mean, uhhh,

WAAAAAHHHHHAAAUURRRROOWOWWWWWRRRRRHHHGGG!!!!

(this thread is great. keep it around so next year's MCATer's can use it 😀 ...)
Click to expand...
i didn't realize this scream was only for MCATers; i needed to scream too
 
Upvote 0 Downvote
psycho, I think it's ok for anyone to scream here.

Not only did I understand the nucleic acid scream, but I also sat here and read through two pages of people's screams. 🙄 I'm too drained to scream. How about a sigh instead? (inhale) HUUUUUUUUUUUUUUUUH
 
Upvote 0 Downvote
QofQuimica said:
psycho, I think it's ok for anyone to scream here.

Not only did I understand the nucleic acid scream, but I also sat here and read through two pages of people's screams. 🙄 I'm too drained to scream. How about a sigh instead? (inhale) HUUUUUUUUUUUUUUUUH
Click to expand...
Sounds more like a musing then a sigh.
 
Upvote 0 Downvote
sssssssssshhhhhhhhhhhiiiiiiiiiiiiiiiiiiiiiiiiiiiiittttttttttttttttttttttttttttt.............i mean pppppppppooooooooooooooooooooooooooooooooooooo
 
Upvote 0 Downvote
QofQuimica said:
psycho, I think it's ok for anyone to scream here.

Not only did I understand the nucleic acid scream, but I also sat here and read through two pages of people's screams. 🙄 I'm too drained to scream. How about a sigh instead? (inhale) HUUUUUUUUUUUUUUUUH
Click to expand...

It that case, I'll join the screaming too...


AAAAAAAAAAAAAAaaaaaaaaaaaaAAAAAAAAAAAAhhhhhhhhhhhhhhHHHHHHHH.....

my two hardest finals are on monday and I finally have time to study, but i keep distracting myself 🙁🙁🙁
 
Upvote 0 Downvote
shantster said:
AAAAAAAAAAAAAAaaaaaaaaaaaaAAAAAAAAAAAAhhhhhhhhhhhhhhHHHHHHHH.....

my two hardest finals are on monday and I finally have time to study, but i keep distracting myself 🙁🙁🙁
Click to expand...

Same here!! :scared:

aaaaiiiiiiieeeeeeeeeeeeeeeeeeeeee!! 😱 :scared:
 
Upvote 0 Downvote
😡 😡 +pissed+ +pissed+ :barf: :barf: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH! Wow I feel better now how about you. :laugh:
 
Upvote 0 Downvote
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ahh that felt betAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA i think i'm ok nAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ok for real. sleepy time.
 
Upvote 0 Downvote
You must log in or register to reply here.
Top