DNA Translation/Transcription

[Kovox]

OKay, I feel like a complete idiot but I don't understand this question, can someone help me out:


Question:
Using the table containing the triplet code, and your knowledge of transcription and translation, analyze the attached DNA sequence and answer the following questions.

(Assume that the promoter sequence is TTGACAN17 TATAAT and a ribosome binding site is GGAGG)

A. What is potential RNA sequence that might be encoded by this fragment?
B. What would you expect the translation products to be

CTAGTGGGTCGCGGGCATCACACATCCTCCTTCCGCGTTCTCTACAAATCATGGAATCCTTCCATCCTCCGGGGATCCATTATATAGGGGAATTCCCCTAGTGTCAAGGGATCCGGG

I thought you were supposed to find the promotoer sequence, then find ATG then start translating but that isn't right. What the heck am I doing wrong? I know you just can't start translating...ug i Never did undrestand promotoers...am I supposed to count 10 sequences down from the promoter sequence or something?

---

Members don't see this ad.

 

[An Yong]

Wow, its been so long since I took Cell Bio.

Curious, what does the 17 in : TTGACAN17 represent? I've never seen any numbers in a nucleotide sequence before.

 

[BrainDrain]

I'll give it a try:

This is the given DNA:

5'-CTAGTGGGTCGCGGGCATCACACATCCTCCTTCCGCGTTCTCTACAAATCATGGAATCCTTCCATCCTCCGGGGATCCATTATATAGGGGAATTCCCCTAGTGTCAAGGGATCCGGG-3'

So the opposite DNA strand running 5'-3'will be:

5'-CCCGGATCCC"TTGACA"CTAGGGGAATTCCCCTA"TATAAT"GGATCCCCGGAGGATGGAAGGATTCCATGATTTGTAGAGAACGCGGAAGGAGGATGTGTGATGCCCGCGACCCACTAG-3'

Look for the promoter sequence TTGACA N17 TATAAT, count 10bp downstream and start transciption. Remember that T=U in RNA. You will get this:

5'-"GGAGG"AUGGAAGGAUUCCAUGAUUUGUAGAGAACGCGGAAGGAGGAUGUGUGAUGCCCGCGACCCACUAG-3'

Then on the RNA, find the ribosomal binding site GGAGG and start translation at the AUG and fill in the amino acids until you hit an "in-frame" stop codon.

 

[Kovox]

Thank you BrainDrain. That clears up a lot of confusion on my part.

My thinking was zonked:

1. DNA replicates
2. Complementary strand created
3. Original Strand made from Complementary strand
4. Therefore you can just use original strand to find the promoter sequence etc

Now I see what I am doing wrong!

May I ask you what text book you use to study your sciences? It seems like the ones I have just give you basic information about the promotoers and stuff but it does not give you practice problems like the one I posted.

Thanks!

 

[BrainDrain]

Kovox,

I realized a mistake in my answer and have since edited it. I forgot that transcription starts 10bp downstream of the TATA box.

I studied from "Molecular Cell Biology" by Lodish et al. There are some practice problems but it is mainly a good source of reference.

 

[Kovox]

Originally posted by BrainDrain
Kovox,

I realized a mistake in my answer and have since edited it. I forgot that transcription starts 10bp upstream of the TATA box.

I studied from "Molecular Cell Biology" by Lodish et al. There are some practice problems but it is mainly a good source of reference.

Why does it matter that the transcription starts 10bp upstream of the tata box? Can't you just find the ribosome binding site, then find the ATG start codon and begin transcription?

 

[BrainDrain]

Kovox,

You may be confusing transcription and translation. DNA gets TRANSCRIBED to RNA , and RNA gets TRANSLATED to protein.

That being said, TRANSCRIPTION starts 10bp DOWNSTREAM of the TATA box.
Once you have your RNA transcribed, TRANSLATION starts at the AUG codon that follows the ribosome-binding site.