OKay, I feel like a complete idiot but I don't understand this question, can someone help me out:
Question:
Using the table containing the triplet code, and your knowledge of transcription and translation, analyze the attached DNA sequence and answer the following questions.
(Assume that the promoter sequence is TTGACAN17 TATAAT and a ribosome binding site is GGAGG)
A. What is potential RNA sequence that might be encoded by this fragment?
B. What would you expect the translation products to be
CTAGTGGGTCGCGGGCATCACACATCCTCCTTCCGCGTTCTCTACAAATCATGGAATCCTTCCATCCTCCGGGGATCCATTATATAGGGGAATTCCCCTAGTGTCAAGGGATCCGGG
I thought you were supposed to find the promotoer sequence, then find ATG then start translating but that isn't right. What the heck am I doing wrong? I know you just can't start translating...ug i Never did undrestand promotoers...am I supposed to count 10 sequences down from the promoter sequence or something?
Question:
Using the table containing the triplet code, and your knowledge of transcription and translation, analyze the attached DNA sequence and answer the following questions.
(Assume that the promoter sequence is TTGACAN17 TATAAT and a ribosome binding site is GGAGG)
A. What is potential RNA sequence that might be encoded by this fragment?
B. What would you expect the translation products to be
CTAGTGGGTCGCGGGCATCACACATCCTCCTTCCGCGTTCTCTACAAATCATGGAATCCTTCCATCCTCCGGGGATCCATTATATAGGGGAATTCCCCTAGTGTCAAGGGATCCGGG
I thought you were supposed to find the promotoer sequence, then find ATG then start translating but that isn't right. What the heck am I doing wrong? I know you just can't start translating...ug i Never did undrestand promotoers...am I supposed to count 10 sequences down from the promoter sequence or something?