AAMC Official Guide to the MCAT Q&A

Started by Gauss44
This forum made possible through the generous support of SDN members, donors, and sponsors. Thank you.
If you got #28 in AAMC's Official Guide to the MCAT VR section correct, would you please explain your reasoning to me?

#28 is about "the relationship between history and science in the final paragraph."
 
I did passage sets and discretes for bio. Is the recent MCAT this specific? I had to guess on some of the discretes because EK never went over stuffs like types of tissue, layers of skin!
 
Advertisement - Members don't see this ad
This is for O-Chem #3 in the second edition (possibly the same for 3rd edition?):

This is the problem observing the Rf retention factor for 2,3-dimethyloxazolidine and the secondary amine with an OH and NH group. Can someone explain why the 2,3-dimethyloxazolidine is less polar as mentioned in the solution? I thought they would be similarly polar and thus have identical Rf values.
 
Advertisement - Members don't see this ad
Secondary amine does not have O. It's a Nitrogen connected to two alkyl groups, and one hydrogen. This will allow the amine to hydrogen bond. However, the compound in question "2,3-dimethyl~~~" does not have a hydrogen bonding capacity because it does not have a hydrogen connected to O, or N. While it's true that "2,3-dimethyl~~" is slightly polar due to C-O and C-N bond, secondary amine is far more polar and will not be able to travel far (lower Rf) in non-polar solution.
 
Secondary amine does not have O. It's a Nitrogen connected to two alkyl groups, and one hydrogen. This will allow the amine to hydrogen bond. However, the compound in question "2,3-dimethyl~~~" does not have a hydrogen bonding capacity because it does not have a hydrogen connected to O, or N. While it's true that "2,3-dimethyl~~" is slightly polar due to C-O and C-N bond, secondary amine is far more polar and will not be able to travel far (lower Rf) in non-polar solution.

Yeah but I think that it's not only the secondary amine in this question that is contributing to it's polarity right? That's why the solution says "... the secondary amine in which the -OH and -NH- groups exist." There is an -OH group that is at the end of the secondary amine group which also has a partial minus charge. I hope this is right.
 
Ohhh it's talking about THE secondary amine that is used to produce "2,3-dimethyl~~." Yup both OH and NH can hydrogen bond. I thought it was talking about any secondary amine in general.
 
I heard you can get it for cheap like 10 bucks or something if you buy it with one of the practice tests. I found it useful to adjust to AAMC style passages after doing TBR. Plus I got it for free via FAP
 
For bio question #34:

Q: Which of the following would NOT change within a sarcomere during skeletal muscle contraction?

Can someone explain (preferably with a citation because I can't find it online) why choice D is incorrect? The book says that D is incorrect because the positions at which the globular heads of the thick filaments bind to the thin filaments does change during muscle contraction.
 
Posting a lot of questions here ...

This question is for the explanation given for bio #39.

Q: Of postpubescent human male and female reproductive organs, in which, if either, do the germ cells regularly undergo mitosis to produce daughter cells that go on to become gametes?

I agree with the answer, but I don't agree with something said in the explanation --

"... The spermatogonia divide by mitosis, providing cells for gametogenesis while also maintaining the germ cell population. The cells that are destined to become spermatozoa divide twice more by MITOSIS before undergoing meiosis and packaging to become spermatozoa."

My understanding is this -- that spermatogonia undergo mitosis to replenish the germ cell (make 1 germ cell) and to make one primary spermatocyte. Primary spermatocytes undergo two meiotic divisions to become 4 spermatozoa. So I think that in total, one round of mitosis following two rounds of meiosis total. But the explanation given in the book says that spermatogonia undergoes mitosis, then two more rounds of mitosis before meiosis. This doesn't make sense to me.

My thinking is what is shown in this video:

http://highered.mcgraw-hill.com/olc...72437316/120112/anim0043.swf::Spermatogenesis
 
I was having trouble with this question (from the discrete questions in the physics section)

Suppose electrons are moving at a constant velocity away from a source of microwaves. The electrons will interact with microwaves having a frequency that:

A. increases with time
B. decreases with time
C. is higher than the frequency of the waves emitted by the source
D. is lower than the frequency of waves emitted by the source

The answer is D. (highlight).

The solution explanation goes on to say that is an application of the Doppler effect; because the electrons are moving away from the source, the wavelength increases and the frequency decreases. I don't understand how one was supposed to tell this question was testing you on the Doppler effect..what part of the question would tip you off? I was confused on how to interpret this question, especially the word "interact."
 
Advertisement - Members don't see this ad
Posting a lot of questions here ...

This question is for the explanation given for bio #39.

Q: Of postpubescent human male and female reproductive organs, in which, if either, do the germ cells regularly undergo mitosis to produce daughter cells that go on to become gametes?

I agree with the answer, but I don't agree with something said in the explanation --

"... The spermatogonia divide by mitosis, providing cells for gametogenesis while also maintaining the germ cell population. The cells that are destined to become spermatozoa divide twice more by MITOSIS before undergoing meiosis and packaging to become spermatozoa."

My understanding is this -- that spermatogonia undergo mitosis to replenish the germ cell (make 1 germ cell) and to make one primary spermatocyte. Primary spermatocytes undergo two meiotic divisions to become 4 spermatozoa. So I think that in total, one round of mitosis following two rounds of meiosis total. But the explanation given in the book says that spermatogonia undergoes mitosis, then two more rounds of mitosis before meiosis. This doesn't make sense to me.

My thinking is what is shown in this video:

http://highered.mcgraw-hill.com/olc...72437316/120112/anim0043.swf::Spermatogenesis

I realize this post is almost a year old, but I also had an issue with this explanation. I got the answer correct, but I am not sure about the whole "2 more rounds of mitosis" bit. Interestingly enough, this pic appears to possibly show one additional round of mitosis after the 1st round in which the germ cell line is replenished:
upload_2014-4-6_21-27-15.png


For bio question #34:

Q: Which of the following would NOT change within a sarcomere during skeletal muscle contraction?

Can someone explain (preferably with a citation because I can't find it online) why choice D is incorrect? The book says that D is incorrect because the positions at which the globular heads of the thick filaments bind to the thin filaments does change during muscle contraction.

Again, I'm sure you don't care about an answer because you probably already took the MCAT, but perhaps others might:

What choice D is referring to is the fact that the myosin heads bind to a site, contract, release it, and then bind to the next site in a sort of "walking" fashion. See video below. Skip to 2:55 for the "walking-like" motion where the "positions at which the globular heads of the thick filaments bind to the thin filaments" are continuously changing during contraction. Start at 1:44 for the main steps of the sliding filament theory.



I was having trouble with this question (from the discrete questions in the physics section)

Suppose electrons are moving at a constant velocity away from a source of microwaves. The electrons will interact with microwaves having a frequency that:

A. increases with time
B. decreases with time
C. is higher than the frequency of the waves emitted by the source
D. is lower than the frequency of waves emitted by the source

The answer is D. (highlight).

The solution explanation goes on to say that is an application of the Doppler effect; because the electrons are moving away from the source, the wavelength increases and the frequency decreases. I don't understand how one was supposed to tell this question was testing you on the Doppler effect..what part of the question would tip you off? I was confused on how to interpret this question, especially the word "interact."

I admit, the term "interact" did throw me off at first too, but once you realize that it's just a doppler question in disguise, it's very easy and straightforward. I bolded the key terms in the question (in the quote above) that should tip you off that this is a doppler question. Whenever they talk about movement away or toward a source of waves (in this case EM radiation), start to think possible doppler.
 
Physics #3

"Global atmospheric circulation is driven by differences in the air temperature at different latitudes. Equatorial regions are heated more by the incident sunlight than are polar regions because"

Answer: sunlight is incident on Earth at smaller angles to the horizontal in the polar regions

If you look at this:
earth_sun_angles.gif


Then yes, the answer makes sense.

But how do you know the measure angles starting from the Vertical up and down axis (and not the NORMAL - which in this case, would be the HORIZONTAL)?

I thought when thinking about incident light, you would measure things relative to the normal.
 
4. What is the effect on the sea level when icebergs melt in the ocean?

A. Sea level rises because of the increase of liquid from the melted ice.
C. Sea level remains approximately the same because a floating iceberg displaces its weight in water.

How can C be correct if the "SEA" and "OCEAN" contain SALT water?
 
@Gauss44

I'm pretty sure it doesn't matter what the ocean is made of. It could be made of mercury and the answer would be the same.

The ice displaces the amount of volume equal to its weight. When it melts, it still weighs the same amount. There is no net increase.
 
Can anyone explain # 11 in the orgo section, which reads: "Given that only one of the initial 12 POPs is a polychlorinated saturated hydrocarbon, which of the following compounds was not on the initial list?" So the question is asking you to pick the saturated compound, but the correct answer is a polychlorinated ring. Everything I've seen so far says rings have at least one degree of unsaturation. What am I missing?
orgo saturated 1.jpg
 
Can anyone explain # 11 in the orgo section, which reads: "Given that only one of the initial 12 POPs is a polychlorinated saturated hydrocarbon, which of the following compounds was not on the initial list?" So the question is asking you to pick the saturated compound, but the correct answer is a polychlorinated ring. Everything I've seen so far says rings have at least one degree of unsaturation. What am I missing?
Just in case you haven't taken your test yet: you are correct that rings have at least 1 degree of unsaturation. But this question is referring to something slightly different. It is asking you to pick out the saturated hydrocarbon meaning the one with no double or triple bonds.
 
Advertisement - Members don't see this ad
Starting with the translation initiation codon, the following sequence encodes a polypeptide of how many amino acids?
5 - C UGCCAAUGUGCUAAUCGCGGGGG - 3
A. 2
B. 3
C. 6
D. 8
Answer A. Can someone explain. I get that AUG is the start codon and UAA is the stop. Don't get how that translates the given chain to 2 amino acids. Thanks.
 
Starting with the translation initiation codon, the following sequence encodes a polypeptide of how many amino acids?
5 - C UGCCA AUG (start, methionine) UGC (cysteine) UAA (STOP) UCGCGGGGG - 3
A. 2
B. 3
C. 6
D. 8
Answer A. Can someone explain. I get that AUG is the start codon and UAA is the stop. Don't get how that translates the given chain to 2 amino acids. Thanks.

Highlighted above what I think they're going for here. So it codes from Met-Cys (MC).
 
Biology Passage 2, Question 5.

What control experiment was necessary to ensure that the apparent subcellular locations of the cat6xbs and lacY6xbs transcripts were NOT skewed by the location preference of the bound MS2-GFP?

Is the correct answer choice basically describing the control?
 
psychology question in the official guide to the mcat, new book.

Can anyone explain why naloxone would increase the reinforcing effect of heroin?
I am confused because naloxone is an endorphin antagonist and therefore heroin should not work at all?
why is it even more reinforcing?
 
The study shows that rats can become addicted to substances that increase their endorphins. If naloxone blocks the endorphin receptors then the rats will not feel the effects of the heroin, and therefore, seek out more heroin. Since the rats are already addicted to the heroin, blocking the receptors does not stop the cravings.

I think you answered your own question, by saying that naloxone is an endorphin antagonist. It doesn't mean that heroin doesn't work, it means that the rats are taking the heroin but not getting the desired effects of an increase in endorphins. The rats' "cravings" are NOT satisfied which increases the reinforcing effect of heroin. This is also demonstrated in Figure 1. The rats that displayed more addictive behaviors and sought out increases in endorphins were more affected (aka had higher withdrawal symptoms = the effects of heroin) when their endorphin receptors were blocked by naloxone.

Let's say you like to eat and you become addicted to food. Then you are given something that blocks your ability to detect that you've just eaten. You would still feel hungry right? (My attempt to make the study relatable!)

I hope this makes sense and possibly helps you!
 
psychology question in the official guide to the mcat, new book.

Can anyone explain why naloxone would increase the reinforcing effect of heroin?
I am confused because naloxone is an endorphin antagonist and therefore heroin should not work at all?
why is it even more reinforcing?
I forgot to reply to your message. My hopefully helpful explanation is above.
 
Advertisement - Members don't see this ad