AMA (ask me anything)

This forum made possible through the generous support of SDN members, donors, and sponsors. Thank you.

CodeBlu

Dream Weaver
Lifetime Donor
10+ Year Member
Joined
Oct 13, 2010
Messages
11,020
Reaction score
169
Points
5,201
Location
The Ether
  1. Fellow [Any Field]
Advertisement - Members don't see this ad
Hey SDN,

I've been in medical school for about a month now... It seems like I've got another 100 months to go, when it's actually only 47 months. I emphasize, you should not let medical school take over your life. Keep friends that are outside of medicine close. Not that I don't love my classmates, but holy cow... all medicine, all the time... makes you go bonkers.

Today I was getting bogged down in the details. So much randomness, all the time. There is always studying you could be doing, but it's not worth your sanity or happiness.

If I could change one thing from when I was a pre-med it would be to value time off where you actually have nothing to do. In med school, it seems that there's always a free lunch/talk/presentation, intramural team, interest club, shadowing doctors.

It can be overwhelming, but if you're wondering if it's worth all the trouble of the MCAT and applying...? My answer is indubitably... YES! I love every second of the mayhem. I just hope I'm still in one piece when I'm done.


If you have any questions, I'll try to procrastinate studying biochem, and will answer them here 🙂
 
I do!!! I'll keep is short so you don't procrastinate too much lol

When people say that you have no time to yourself in medical school, is that really true? Like 24 hrs of your day everyday is studying/ in class or sleeping/eating. Do you get an hour to yourself on the weekends at least?

I'm just trying to rationalize exactly how much of a life you don't have in medical school lol I'm not sure if what I hear is exaggeration or an understatement 😕

And assuming I'm not a genius, but not an idiot either.. average intellectual ability.. needing an average amount of time to study etc.
 
Will you be putting your MDapps back online now that you've started medical school?
 
If you have any questions, I'll try to procrastinate studying biochem, and will answer them here 🙂

I have 2 so bare with me:

1) What's the pH of 0.35 M acetic acid (pKa = 4.76)

2) Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme EcoR I, BamHI, SmaHI, KpnI and Hind III; respectively:
5’ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3’
3’TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAAC5’
 
I do!!! I'll keep is short so you don't procrastinate too much lol

When people say that you have no time to yourself in medical school, is that really true? Like 24 hrs of your day everyday is studying/ in class or sleeping/eating. Do you get an hour to yourself on the weekends at least?

I'm just trying to rationalize exactly how much of a life you don't have in medical school lol I'm not sure if what I hear is exaggeration or an understatement 😕

And assuming I'm not a genius, but not an idiot either.. average intellectual ability.. needing an average amount of time to study etc.

Sorry to jump in here Codeblu, but that is definitely false. You will be busier than in undergrad, have less time to do things outside of school, but you will have some time. How much time is very person specific, but if you don't need to study 60 hours a week to keep your grades up in undergrad, you will have down time as a med student.
 
Sorry to jump in here Codeblu, but that is definitely false. You will be busier than in undergrad, have less time to do things outside of school, but you will have some time. How much time is very person specific, but if you don't need to study 60 hours a week to keep your grades up in undergrad, you will have down time as a med student.

Okay thanks! Feel a lot more relieved because I don't think I can go 24/7 with no time to myself at all.
 
What is one thing that you wish you would have known earlier/done differently during pre-med. (I know you said value time off, but I'm trying to get at a more pre-medy type answer 😛)
 
If you have any questions, I'll try to procrastinate studying biochem, and will answer them here 🙂

Gray's Student Edition or Moore's COA?
 
Are the females in your class pickier about the men they have sex with or less picky?
 
Advertisement - Members don't see this ad
Netters or rohans?

Sent from my SGH-T999 using SDN Mobile
 
I do!!! I'll keep is short so you don't procrastinate too much lol

When people say that you have no time to yourself in medical school, is that really true? Like 24 hrs of your day everyday is studying/ in class or sleeping/eating. Do you get an hour to yourself on the weekends at least?

I'm just trying to rationalize exactly how much of a life you don't have in medical school lol I'm not sure if what I hear is exaggeration or an understatement 😕

And assuming I'm not a genius, but not an idiot either.. average intellectual ability.. needing an average amount of time to study etc.

to give a bit of perspective from the other end of the med school journey.....

during the pre-clinical years your statement is an exaggeration. you will have plenty of free time ...especially once you figure out how to study efficiently. the biggest issue i found was that i spent a lot of my free time worrying about med school (especially during second year with step 1 looming) so it wasn't particularly enjoyable. during first year i would sit in the library and "study" inefficiently for hours because i felt that's what i needed to do and would feel guilty about walking away from the books and actually relaxing. despite doing the aforementioned i still had plenty of time to myself but looking back at it i totally regret worrying so much about grades during the first two years.

during the clinical years on the other hand your statement will sometimes hold true or even be an understatement. during surgery, OB and medicine subI (subinternship ...basically like an acting internship or sometimes called junior internship) some days you will literally come home at 8pm, eat then sleep so you can be up early the next morning to do it all over again.
 
Coke or Pepsi?

Seriously though - what's the biggest difference between now and undergrad? What did you do your summer before med school?
 
Netters or rohans?

Sent from my SGH-T999 using SDN Mobile

Rohen for pics of real bodies for when you can't be in lab + Gilroy for the great illustrations, good clinical tidbits, decent organization and pretty good charts although I've seen a mistake or two. The downside is that it's hard to see everything together although you don't have it all thrown at you on one page.

I also have Moore's but I only use it for the blue boxes.
 
Netters or rohans?

Sent from my SGH-T999 using SDN Mobile
Haha I bet we'll all have different answers to this.

I don't like Rohen's. I prefer the illustrations in Thieme's but the labeling in Netter's seems to be more polished and ready to be used as a med school level resource. If I want to see dissected specimens, I usually watch the Acland videos (speeding them up a bit) instead of looking at Rohen's
 
I do!!! I'll keep is short so you don't procrastinate too much lol

When people say that you have no time to yourself in medical school, is that really true? Like 24 hrs of your day everyday is studying/ in class or sleeping/eating. Do you get an hour to yourself on the weekends at least?

I'm just trying to rationalize exactly how much of a life you don't have in medical school lol I'm not sure if what I hear is exaggeration or an understatement 😕

And assuming I'm not a genius, but not an idiot either.. average intellectual ability.. needing an average amount of time to study etc.

You don't have to be a genius to do med school. Honestly, I've got class only in the mornings and one PBL group in the afternoon and a clinical skills thing. So I have 3 afternoons off. In reality, I have a decent amount of "free time." At least 4 hours a day, and I go to bed at a late hour usually.

Will you be putting your MDapps back online now that you've started medical school?

Eventually...

I have 2 so bare with me:

1) What's the pH of 0.35 M acetic acid (pKa = 4.76)

2) Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme EcoR I, BamHI, SmaHI, KpnI and Hind III; respectively:
5'ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3'
3'TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAAC5'


The answer is C.

Sorry to jump in here Codeblu, but that is definitely false. You will be busier than in undergrad, have less time to do things outside of school, but you will have some time. How much time is very person specific, but if you don't need to study 60 hours a week to keep your grades up in undergrad, you will have down time as a med student.

Undergrad was less busy. That's for sure. But med school is fast paced. In reality you could spread the basic sciences out of 3 or 4 years and it wouldn't be so bad. But learning everything there is to know about the cardiovascular system in 6 weeks is sort of daunting.

What is one thing that you wish you would have known earlier/done differently during pre-med. (I know you said value time off, but I'm trying to get at a more pre-medy type answer 😛)

I wish that I had spent more time at the gym. I've worked the gym into my routine now and it makes life infinitely better. But from an academic stand point, I wish I had learned to summarize more effectively. Taking a 50 minute lecture and condensing it down to one page of writing is super important imo.

Do you drink on a regular basis? Socially? Parties? Night out after an exam?

For the last month, I have gone out every weekend. And my class likes to get rowdy... we had a "talking to" by one of the deans, because we were showing up to class hung over and the profs were catching on.

Gray's Student Edition or Moore's COA?

Gray's... but I like Rohen's way better.

Are the females in your class pickier about the men they have sex with or less picky?

Less picky. One girl had sex with 5 guys in one weekend.

Netters or rohans?

Sent from my SGH-T999 using SDN Mobile

Rohen's for sure.

Coke or Pepsi?

Seriously though - what's the biggest difference between now and undergrad? What did you do your summer before med school?

Coke ZERO

The biggest difference between now and undergrad, is that the stuff I'm doing now actually matters. I'm probably going to need to know some of these things to save someones life one day.

My summer before medical school consisted of me traveling Europe and spending a lot of money I didn't have.
 
Haha I bet we'll all have different answers to this.

I don't like Rohen's. I prefer the illustrations in Thieme's but the labeling in Netter's seems to be more polished and ready to be used as a med school level resource. If I want to see dissected specimens, I usually watch the Acland videos (speeding them up a bit) instead of looking at Rohen's

Thieme's is a good one too. It's infinitely better than Gray's and Netter's.
 
I missed you CodeBlu. How do you make AOA in medical school and what is teh selection criteria? Are you AOA? What about research. Are professors receptive with M! and M2 students in terms of joining a lab?
 
Not a question so much as a comment...After reading a little about your story on your MDApps, I really admire you. That's all. 😳
 
Do you recommend getting my own apartment when I attend medical school? Or is it better to do student housing and get on the same train as everyone?
 
Advertisement - Members don't see this ad
I missed you CodeBlu. How do you make AOA in medical school and what is teh selection criteria? Are you AOA? What about research. Are professors receptive with M! and M2 students in terms of joining a lab?

I don't think you can be AOA after only a month.

Sent from my SGH-T999 using SDN Mobile
 
Do you have many non-trads and/or older med students in your class?
 
Is your muffin buttered? Would you like someone to butter your muffin?
 
Are there are a lot of single people there or are there couples? If there are couples, do any of them seem promiscuous?

How are the members of your class? Nice, competitive, douchey, helpful?
 
I missed you CodeBlu. How do you make AOA in medical school and what is teh selection criteria? Are you AOA? What about research. Are professors receptive with M! and M2 students in terms of joining a lab?

Yes, professors are very receptive. As far as AOA goes, I don't really care. Hahaha. I go to a strictly pass/fail school, so I don't know how they determine AOA if they do at all...

Not a question so much as a comment...After reading a little about your story on your MDApps, I really admire you. That's all. 😳

Thanks 🙂

Do you recommend getting my own apartment when I attend medical school? Or is it better to do student housing and get on the same train as everyone?

I highly recommend it. I live in a house with some friends right now, while it's awesome, I do miss living alone sometimes. I most likely will move out next year and into my own 1 bedroom I think.

Do you have many non-trads and/or older med students in your class?

I know of at least 5-6 that I hang out with that are non-trads (engineering, math, psych etc.) There are a few older people in my class, oldest person is 30. Our average age is 22... so that's an indication.

Is your muffin buttered? Would you like someone to butter your muffin?

I think I buttered your muffin...

Do you like Lil B?

Just googled him... seems aiite.

Are there are a lot of single people there or are there couples? If there are couples, do any of them seem promiscuous?

How are the members of your class? Nice, competitive, douchey, helpful?

There is a fair amount of single people. Although there are two newly formed relationships between classmates... Hahah.

Generally they are all pretty nice and helpful. You can see people still holding onto the gunner mentality of undergrad. Now, that doesn't matter really. One day one of my classmates might be saving my family members/friends life. So you better be damned sure that I am going to make it a point that they know what they're doing.

There are a few keeners/gunners. They've already identified themselves pretty clearly. I steer clear. I prefer the slacker approach right now. Work smart, not hard.

Nah man, you're pretty much a doctor after a month.

Yeah, that's the consensus. I can take a really good history and physical... sort of.
 
Why is kpcrew answering questions in your AMA?
 
Less picky. One girl had sex with 5 guys in one weekend..

😱 am I the only one that caught this?!? Wtf?! Not only is that disgusting, but almost a record. Are you including friday in the weekend, or just Saturday and Sunday. If only 2 days then she has sex with 3 guys in 1 day?! If you're including Friday then she had sex with 1 guy and let another rub around each day?! This is nuts
 
Advertisement - Members don't see this ad
😱 am I the only one that caught this?!? Wtf?! Not only is that disgusting, but almost a record. Are you including friday in the weekend, or just Saturday and Sunday. If only 2 days then she has sex with 3 guys in 1 day?! If you're including Friday then she had sex with 1 guy and let another rub around each day?! This is nuts

I'm quite surprised that no one dwelled on this one fact alone. Is it like some kind of orgy situation? How do you even manage that?
 
😱 am I the only one that caught this?!? Wtf?! Not only is that disgusting, but almost a record. Are you including friday in the weekend, or just Saturday and Sunday. If only 2 days then she has sex with 3 guys in 1 day?! If you're including Friday then she had sex with 1 guy and let another rub around each day?! This is nuts

I believe it works out to 2.5 guys per day 😀😀
 
I'm quite surprised that no one dwelled on this one fact alone. Is it like some kind of orgy situation? How do you even manage that?

Ahh duh, I didn't even think about orgies or trains, well I guess she is saving time because that way she doesn't have to have sex with each one individually, so really, she's pretty organized.


And now the cheechoo guy is popping boners cuz I said train
 
Ahh duh, I didn't even think about orgies or trains, well I guess she is saving time because that way she doesn't have to have sex with each one individually, so really, she's pretty organized.


And now the cheechoo guy is popping boners cuz I said train

Well, they say that the biggest improvement that you have to make in the transition from undergrad to medical school is time management so I guess she's doing quite well. 🙄
 
Hey SDN,

I've been in medical school for about a month now... 🙂

Um, the first month is generally not representative. Most places kind of ease you in. It takes a few exam periods before people get their grove, figure out how to study. Folks who come out on top after the first exam often ease back to the middle as everyone else figures out what went wrong, and so for some people study hours go up, others become less inefficient and can go down. Many people think they know what's going on after a month, only to realize that everyone else makes adjustments faster. People experiment with attending lectures or not, studying in group or not. Basically it's like asking folks how they like climbing mount Everest about an hour after leaving base camp as opposed to waiting until they get closer to the top. Some will think they have it figured out only to die of exposure a day or two later. I strongly recommend holding off telling folks "how it us" until you start winding down on your third year. Just my two cents.
 
Um, the first month is generally not representative. Most places kind of ease you in. It takes a few exam periods before people get their grove, figure out how to study. Folks who come out on top after the first exam often ease back to the middle as everyone else figures out what went wrong, and so for some people study hours go up, others become less inefficient and can go down. Many people think they know what's going on after a month, only to realize that everyone else makes adjustments faster. People experiment with attending lectures or not, studying in group or not. Basically it's like asking folks how they like climbing mount Everest about an hour after leaving base camp as opposed to waiting until they get closer to the top. Some will think they have it figured out only to die of exposure a day or two later. I strongly recommend holding off telling folks "how it us" until you start winding down on your third year. Just my two cents.

Glad I'm not the only one.

While I'm sure this is interesting for folks eager to get into med school, you should take anything said here with a huge grain of salt. Being in med school for a month isn't enough to give you a reasonable perspective of the experience.
 
I have 2 so bare with me:

1) What's the pH of 0.35 M acetic acid (pKa = 4.76)

2) Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme EcoR I, BamHI, SmaHI, KpnI and Hind III; respectively:
5’ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3’
3’TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAAC5’

How does a resident remember junk like that?
 
Advertisement - Members don't see this ad
Like drinking water out of a firehouse...

More like drinking Butters' Creamy Goo.
tumblr_mb0cfqbA0o1qeoy1po1_1280.png


Take that, Tom Brady!
 
I have 2 so bare with me:

1) What's the pH of 0.35 M acetic acid (pKa = 4.76)

2) Give the restriction fragments obtained following digestion of the following nucleic acid with the enzyme EcoR I, BamHI, SmaHI, KpnI and Hind III; respectively:
5’ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3’
3’TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAAC5’

I apologize ahead of time if there is some errors below. I'm not a medical student yet because I can't break a 32 on the MCAT and no one will accept me until I do. I did get straight A's throughout college though (not that it really matters :laugh:). I know you probably wanted an actual medical student answering your questions, but here's my lowly answers to the best of my abilities (which aren't admittedly that great as I've yet to get accepted into a medical school).

1) Couldn't you just use the Berkeley review trick. It's a weak acid so:

ph = 1/2pka + 1/2log[concentration]
= 1/2 (.4.76) + 1/2 log (.35)

On the MCAT, they tend to have their answer choices pretty spaced out so I would think that you could choose something reasonably close to 2.4 and that would be fine?

2) To the best of my knowledge:

.5’ATGCTCGATC.
.GATCGAATT.
.CTATAGCCC.
.GGGGCTGGATCCAGGTAC.
.CAAGTTA.
.AGCTG3’ .
.
3’TACGAGCTAG.

.CTAGCTTAA.
.GATATCGGG.
.CCCCGACCTAGGTCCATG.
.GTTCAAT.
TCGAA5’

Again, I'm sorry if I'm incorrect and I'm sorry for my ineptitude. Sincerely, hope this helps though.
 
I apologize ahead of time if there is some errors below. I'm not a medical student yet because I can't break a 32 on the MCAT and no one will accept me until I do. I did get straight A's throughout college though (not that it really matters :laugh:). I know you probably wanted an actual medical student answering your questions, but here's my lowly answers to the best of my abilities (which aren't admittedly that great as I've yet to get accepted into a medical school).

1) Couldn't you just use the Berkeley review trick. It's a weak acid so:

ph = 1/2pka + 1/2log[concentration]
= 1/2 (.4.76) + 1/2 log (.35)

On the MCAT, they tend to have their answer choices pretty spaced out so I would think that you could choose something reasonably close to 2.4 and that would be fine?

2) To the best of my knowledge:

.5'ATGCTCGATC.
.GATCGAATT.
.CTATAGCCC.
.GGGGCTGGATCCAGGTAC.
.CAAGTTA.
.AGCTG3' .
.
3'TACGAGCTAG.

.CTAGCTTAA.
.GATATCGGG.
.CCCCGACCTAGGTCCATG.
.GTTCAAT.
TCGAA5'

Again, I'm sorry if I'm incorrect and I'm sorry for my ineptitude. Sincerely, hope this helps though.

Lol. I think you took his post a little too seriously.

(sent from my phone)
 
There are two upper level science courses I am contemplating taking next year.
Biological Chem (offered by the Bio dept) and Biochem. (from Chem dept) I am not taking BIo 200 so my bio foundation is just based on intro Bio 100 (although it was a rather challenging course with the professor that I had).
Which is better to take for med school prep and is more relevant to medicine?
and What is the difference between the two courses?
 
Do you recommend getting my own apartment when I attend medical school? Or is it better to do student housing and get on the same train as everyone?

haha you are your train references. gives me a good chuckle everytime I see one😀
 
There are two upper level science courses I am contemplating taking next year.
Biological Chem (offered by the Bio dept) and Biochem. (from Chem dept) I am not taking BIo 200 so my bio foundation is just based on intro Bio 100 (although it was a rather challenging course with the professor that I had).
Which is better to take for med school prep and is more relevant to medicine?
and What is the difference between the two courses?

I think you should take whichever one is taught by a better professor and you will enjoy more. I am taking the Biochem version at my school because it's taught by a great professor, he makes it somewhat relevant to medicine, and I have learned a great deal. So talk to people that have taken them at your school and decide based on that. From what I've heard, both will probably help you somewhat but neither will be all that close to how it's taught in med school.
 
Advertisement - Members don't see this ad
Top Bottom